Logo
  • Home
  • About Us
  • News
  • FAQ
  • Help
  • Create New Lab
  • Find Research Materials
Login / Register

Find Research Materials

code name description quantity location comments categories subcategories country city lab
43 18S qPCR primers primers for detection of mouse 18S mRNA, FW: CGCCGCTAGAGGTGAAATTC , RV: CCAGTCGGCATCGTTTATGG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
42 rCYP2R1 qPCR primers primers for detection of rat CYP2R1 mRNA, FW: AAACTACAACCAATGTGCTCCG , RV: CTTCCCAAGAAGGCCTCCTGT, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
41 mGAPDH qPCR primers primers for detection of mouse GAPDH mRNA, FW: GGTCATCATCTCCGCCCC, RV: TTCTCGTGGTTCACACCCATC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 Biomedical Biology Finland Oulu
40 mATP5B qPCR primers primers for detection of mouse ATP5B mRNA, FW: GGTTCATCCTGCCAGAGACTA , RV: AATCCCTCATCGAACTGGACG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
39 mABC1 qPCR primers primers for detection of mouse ABC1 mRNA, FW: GCTTGTTGGCCTCAGTTAAGG, RV: GTAGCTCAGGCGTACAGAGAT, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
36 mCYCs qPCR primers primers for detection of mouse Cytochrome C, Somatic mRNA, FW: CCAAATCTCCACGGTCTGTTC , RV: ATCAGGGTATCCTCTCCCCAG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
35 mCYP24A1 qPCR primers primers for detection of mouse CYP24A1 mRNA, FW: CTGCCCCATTGACAAAAGGC, RV: CTCACCGTCGGTCATCAGC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
34 PGC-1BETA qPCR primers primers for detection of mouse PGC-1beta mRNA, FW: CTCCAGGCAGGTTCAACCC, RV: GGGCCAGAAGTTCCCTTAGG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
33 LXRA qPCR primers primers for detection of mouse Liver X Nuclear Receptor alpha mRNA, FW: CTCAATGCCTGATGTTTCTCCT, RV: TCCAACCCTATCCCTAAAGCAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
32 ERRA qPCR primers primers for detection of mouse Estrogen-related receptor alpha mRNA, FW: ATCTGCTGGTGGTTGAACCTG , RV: AGAAGCCTGGGATGCTCTTG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
31 CYP27B1 qPCR primers primers for detection of mouse CYP27B1 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
30 SIRT2 qPCR primers primers for detection of mouse sirtuin2 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
29 SIRT1 qPCR primers primers for detection of mouse sirtuin1 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
28 mTAT qPCR primers primers for detection of mouse Tyrosine aminotransferase mRNA, FW: TGCTGGATGTTCGCGTCAATA, RV: CGGCTTCACCTTCATGTTGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
27 HADHB qPCR primers primers for detection of mouse hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta mRNA, FW: ACTACATCAAAATGGGCTCTCAG, RV: AGCAGAAATGGAATGCGGACC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
26 HADHA qPCR primers primers for detection of mouse hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha mRNA, FW: TGCATTTGCCGCAGCTTTAC, RV: GTTGGCCCAGATTTCGTTCA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
25 mPPARA qPCR primers primers for detection of mouse Peroxisome Proliferator Activated Receptor Alpha mRNA, FW: AGAGCCCCATCTGTCCTCTC, RV: ACTGGTAGTCTGCAAAACCAAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
24 VDRBP qPCR primers primers for detection of mouse VDR binding protein mRNA, FW: CCTGCTGGCCTTAGCCTTT, RV: TGCTCAAATGTGCTACTGGAAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
23 ANGPTL4 qPCR primers primers for detection of mouse ANGPTL4, FW: AAGATGCACAGCATCACAGG , RV: ATGGATGGGAAATTGGAGC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
22 ANGPTL3 qPCR primers primers for detection of mouse ANGPTL3, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
21 mRIP140 qPCR primers primers for detection of mouse RIP140 (Receptor Interacting Protein of 140 kDa)FW1: AGACCAGAACTTTAACCTCTCGGRV1: CGATGGAATCAGACAGCCTCTFW2:TGTCTTAACTTACCTCGAAGGGTRV2:CGTCTGGGTACTGACAGTGGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
20 mLRP2 qPCR primers 1 -20 C Biomedical Biology Finland Oulu
19 FGF21 qPCR primers primers for detection of mouse FGF21FW: GTGTCAAAGCCTCTAGGTTTCTTRV: GGTACACATTGTAACCGTCCTCConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
18 NR1D1 qPCR primers primers for detection of mouse Nuclear Receptor Subfamily 1 Group D Member 1FW: TCCCCAAGAGAGAGAAGCAARV: CTGAGAGAAGCCCACCAAAGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
17 CREBH qPCR primers primers for detection of mouse CREBH (cAMP responsive element binding protein 3 like 3)FW: GTGTCACACCAGGGAGCAAGRV: CAGTGAGGTTGAAGCGGGAGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
16 Fetuin A qPCR primers primers for detection of mouse Fetuin AFW: ATCCGCTCCACAAGGTACAGRV: GGTCCAAAGCATGGCAAGTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
15 CRP qPCR primers primers for detection of mouse C-Reactive protein mRNA.FW: GGCCAGATGCAAGCATCATCRV: CTGGAGATAGCACAAAGTCCCACConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
14 AKT3 qPCR primers primers for detection of mouse AKT Serine/Threonine Kinase3FW: TGGGTTCAGAAGAGGGGAGAARV: AGGGGATAAGGTAAGTCCACATCConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
13 AKT2 qPCR primers primers for detection of mouse AKT Serine/Threonine Kinase2FW: ACGTGGTGAATACATCAAGACCRV: GCTACAGAGAAATTGTTCAGGGGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
12 AKT1 qPCR primers primers for detection of mouse AKT Serine/Threonine Kinase1FW: ATGAACGACGTAGCCATTGTGRV: TTGTAGCCAATAAAGGTGCCATConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
11 VDR qPCR primers primers for detection of mouse vitamin D receptor mRNA.FW: GAATGTGCCTCGGATCTGTGGRV: GGTCATAGCGTTGAAGTGGAAConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical Biology Finland Oulu
10 Mouse Primary Hepatocytes The mouse primary hepatocytes could be obtained from mice by two-step collagenase liver perfusion. If you are interested in obtaining mouse primary hepatocytes, please contact prof. Jukka Hakkola (jukka.hakkola@oulu.fi). 1 -70 C Biomedical Biology Finland Oulu
9 Mouse model of type 1 diabetes ( STZ-model) Type 1 diabetic phenotype was induced by injecting the mice with either vehicle (sod. citrate buffer pH 4.5) or with STZ (60 mg/kg) once daily for 5 days. All mice were kept for a total period of 13 weeks. Additionally, one group of diabetic mice were treated with INSULIN twice a day for 4 weeks before sacrifice. Groups were as follow:
1-vehicle group (non-diabetic controls)= 10 mice
2-STZ group (diabetic mice left untreated)=14 mice
3-STZ + Insulin group (diabetic mice with insulin injections for 4 weeks before sacrificing= 10 mice.

Tissues collected include liver, kidney, heart, muscles, duodenum, ileum, colon, different areas of the brain, brown adipose tissue, testis, and plasma. There is also paraffin blocks from some of these tissues

1 -70 C Biomedical Biology Finland Oulu
8 Mouse experiment (Knockdown the estrogen-related receptor alpha (ERRa) in the liver) C57BL/6N mice, aged 8-9 weeks were inject with either SCR-Ad or ERRA-shRNA-Ad (5*10^9 IFU/mouse) via tail vein. The mice were kept for 8 days in total. Before scarifying, the mice were fed or 12h fasted. the treated mice were as follows SCR-Ad (fed or 12h fast) 10 mice/group and ERRA-shRNA-Ad (fed or 12 fasted) 10 mice/group, non-infected controls (fed or 12h fasted) 10 mice/group. the collected tissues include the Liver, Kidney, white adipose tissue, muscles, and Duodenum. 1 -70 C Biomedical Biology Finland Oulu
7 Mouse experiment (Knockdown the glucocorticoid receptor in the liver) C57BL/6N mice, aged 8-9 weeks were inject with either SCR-Ad or GR-shRNA-Ad (2,4*10^9 IFU) via tail vein. The mice were kept for 8 days in total. Before sacrifying, the mice were fed or 12h fasted. the treated mice were as follows SCR-Ad (fed or 12h fast) 10 mice/group and GR-shRNA-Ad (fed or 12 fasted) 10 mice/group. the collected tissues include the Liver, Kidney, white adipose tissue, muscles, and Deudenum. 1 -70 C Biomedical Biology Finland Oulu
6 Mouse experiment (Inhibit the Glucocorticoid receptor in mouse liver by Mifepristone) The aim was to inhibit the liver GR by GR antagonist mifepristone. C57BL/6N mice, aged 8-9 weeks, were injected with mifepristone (i.p. 100 mg/kg) or vehicle (DMSO/corn oil) two times (the first injection at 9 am and the second injection at 9 pm) and subsequently the mice were either fed or fasted overnight for additional 12h and the tissues were collected. the treated groups were as follow: Vehicle (fed or 12hfast) 8 mice/group and MIF (fed or 12h fast) 8 mice/group. the collected tissues include Liver, Kidney, white adipose tissue, muscles, whole heart, lung, Deudenum, colon, and brown adipose tissues. 1 -70 C Biomedical Biology Finland Oulu
5 Mouse experiment (Mifepristone plus Dexametahsone) The aim was to inhibit the GR and abolish the effect of Dexamethasone on the gene of interest in the liver. C57BL/6N mice aged 8 weeks were injected fasted 1 h before an i.p. injection of dexamethasone (3 mg/kg) dissolved in DMSO/corn oil or vehicle only. Simultaneously with the dexamethasone injections, the GR was inhibited with the GR antagonist mifepristone (i.p. 100 mg/kg) dissolved in DMSO/corn oil. The treated groups are as follows Vehicle, DEXA only, MIF only, and DEXA+MIF, 7 mice/group. The collected tissues include the Liver, Kidney, white adipose tissue, and muscles. 1 -70 C Biomedical Biology Finland Oulu
4 Mouse experiment (Dexamethasone treatment) C57BL/6N mice aged 8 weeks were fasted 1 h before an i.p. injection of dexamethasone (3 mg/kg) dissolved in DMSO/corn oil or vehicle only. The mice have fasted 6 h and the tissues collected. The treated groups were as follows vehicle and Dexa, 7 mice/group. The collected tissues include the Liver, Kidney, white adipose tissue, and muscles. 1 -70 C Biomedical Biology Finland Oulu
3 Hepa1c1c7 Mouse Liver Hepatoma 1 Liquid nitrogen Biomedical Biology Finland Oulu
2 Calu6 Lung carcinoma cell line 1 Liquid nitrogen Biomedical Biology Finland Oulu
1 C3A HepG2/C3A, derivative of Hep G2 1 Liquid nitrogen Biomedical Biology Finland Oulu
2 HEK239 Human Embryonic Kidney 1 Liquid nitrogen Biomedical science Biology, Cell Biology, Biochemistry, Genetics, Zoolgoy Finland Oulu
1 HepG2 Human Hepatoma cell line 1 Liquid nitrogen Biomedical science Biology, Histology, Genetics, Cell Biology, Pharmacology, Physiology Finland Oulu
49 mErrgamma qPCR primers primers for detection of mouse Estrogen-related receptor gammaFW1: GAATCTTTTTCCCTGCACTACGARV1: GCTGGAATCAATGTGTCGATCTTFW2: GACCCTACTGTCCCCGACAGTRV1: AACTCTCGGTCAGCCAAGTCAConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20C Biomedical science Biology, Biochemistry, Pharmacology, Physiology, Toxicology, Zoolgoy, Genetic Engineering, Interdisciplinary Finland Oulu
48 mErrbeta qPCR primers primers for detection of mouse Estrogen-related receptor betaFW: CAGATCGGGAGCTTGTGTTCRV: TGGTCCCCAAGTGTCAGACTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 - 20C Biomedical science Biology, Pharmacology, Physiology, Toxicology, Zoolgoy, Interdisciplinary Finland Oulu
47 mGr qPCR primers primers for detection of mouse Glucocorticoid receptor (NR3C1).FW: AGCTCCCCCTGGTAGAGACRV: GGTGAAGACGCAGAAACCTTGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. -20 C Biomedical science Biology, Biochemistry, Anatomy, Cell Biology, Genetics, Pharmacology, Physiology, Toxicology, Zoolgoy, Interdisciplinary Finland Oulu
46 mAngptl8 qPCR primers primers for detection of mouse Angioboitin-like protein 8FW: CACTGTACGGAGACTACAAGTGCRV: GTGGCTCTGCTTATCAGCTCGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20C Biomedical science Biology, Biochemistry, Pharmacology, Physiology Finland Oulu
45 mPgc1a qPCR primers primers for detection of mouse PGC-1aFW: TCCTCCTCATAAAGCCAACCRV: GCCTTGGGTACCAGAACACTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM. 1 -20 C Biomedical science Biology, Physiology, Pharmacology, Biochemistry Finland Oulu
44 mCyp2r1 qPCR primers primers for detection of mouse CYP2R1FW: AAACTACAACCAATGTGCTCCG, RV: ATTCCCAAGAAGGTCTCCTGT, Concentration used in qPCR is 250 nM Stock 100 uM, working dilution is 10 uM. 1 -20 C Biomedical science Biology, Biochemistry, Pharmacology, Physiology, Zoolgoy Finland Oulu
0 hydratase-3 enzyme 5 mg stord at -70C its frozen Biomedical Biochemistry Finland Oulu
0 dehydrogenase-4 enzyme 1mg stored at -70C its frozen Biomedical Biochemistry Finland Oulu
0 crotonase enzyme 100 mg -70C Biomedical science Biochemistry Finland Oulu
0 trans2-decenoylcooenzyme A fatty acyl Coa susbtrate, lyophilized powder 1 mg -20 C Biomedical science Biochemistry Finland Oulu
0 Cobalt Talon beads cobalt talon beads for IMAC purification10ml 10ml 4C freeze x regenerated talon beads Biomedical Biochemistry Finland Oulu
1 Finland Oulu
name description quantity comments categories subcategories country city lab

Collaboration Bank - © Copyright 2019 - All Rights reserved.

About Us

Contact Us

Facebook - Linkedin

 

Privacy Policy

Terms and Conditions

Not a member? Sign Up

Log In

Welcome to Collaboration Bank

Login

Sign up

Registering for this site is easy. Just fill in the fields below, and we'll get a new account set up for you in no time. If you didn't receive the confirmation email please check your Junk or Spam folder too.

Registration is currently possible only with institutional email, If you are working in a lab but do not have an institutional email please send us a message with your proof document. (Contact Us)

Account Details

Profile Details

Name (required)
Address

Please make sure this address is valid for Google Map.

Institution
ORCID ID

I have read and agree with the Terms and Conditions

Are you sure?

Please confirm deletion. There is no undo!