Find Research Materials – Collaboration Bank

name:

description:

quantity:

comments:

categories:

subcategories:

country:

city:

lab:

code	name	description	quantity	location	comments	categories	subcategories	country	city	lab
43	18S qPCR primers	primers for detection of mouse 18S mRNA, FW: CGCCGCTAGAGGTGAAATTC , RV: CCAGTCGGCATCGTTTATGG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
42	rCYP2R1 qPCR primers	primers for detection of rat CYP2R1 mRNA, FW: AAACTACAACCAATGTGCTCCG , RV: CTTCCCAAGAAGGCCTCCTGT, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
41	mGAPDH qPCR primers	primers for detection of mouse GAPDH mRNA, FW: GGTCATCATCTCCGCCCC, RV: TTCTCGTGGTTCACACCCATC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20		Biomedical	Biology	Finland	Oulu
40	mATP5B qPCR primers	primers for detection of mouse ATP5B mRNA, FW: GGTTCATCCTGCCAGAGACTA , RV: AATCCCTCATCGAACTGGACG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
39	mABC1 qPCR primers	primers for detection of mouse ABC1 mRNA, FW: GCTTGTTGGCCTCAGTTAAGG, RV: GTAGCTCAGGCGTACAGAGAT, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
36	mCYCs qPCR primers	primers for detection of mouse Cytochrome C, Somatic mRNA, FW: CCAAATCTCCACGGTCTGTTC , RV: ATCAGGGTATCCTCTCCCCAG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
35	mCYP24A1 qPCR primers	primers for detection of mouse CYP24A1 mRNA, FW: CTGCCCCATTGACAAAAGGC, RV: CTCACCGTCGGTCATCAGC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
34	PGC-1BETA qPCR primers	primers for detection of mouse PGC-1beta mRNA, FW: CTCCAGGCAGGTTCAACCC, RV: GGGCCAGAAGTTCCCTTAGG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
33	LXRA qPCR primers	primers for detection of mouse Liver X Nuclear Receptor alpha mRNA, FW: CTCAATGCCTGATGTTTCTCCT, RV: TCCAACCCTATCCCTAAAGCAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
32	ERRA qPCR primers	primers for detection of mouse Estrogen-related receptor alpha mRNA, FW: ATCTGCTGGTGGTTGAACCTG , RV: AGAAGCCTGGGATGCTCTTG, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
31	CYP27B1 qPCR primers	primers for detection of mouse CYP27B1 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
30	SIRT2 qPCR primers	primers for detection of mouse sirtuin2 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
29	SIRT1 qPCR primers	primers for detection of mouse sirtuin1 mRNA, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
28	mTAT qPCR primers	primers for detection of mouse Tyrosine aminotransferase mRNA, FW: TGCTGGATGTTCGCGTCAATA, RV: CGGCTTCACCTTCATGTTGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
27	HADHB qPCR primers	primers for detection of mouse hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta mRNA, FW: ACTACATCAAAATGGGCTCTCAG, RV: AGCAGAAATGGAATGCGGACC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
26	HADHA qPCR primers	primers for detection of mouse hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha mRNA, FW: TGCATTTGCCGCAGCTTTAC, RV: GTTGGCCCAGATTTCGTTCA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
25	mPPARA qPCR primers	primers for detection of mouse Peroxisome Proliferator Activated Receptor Alpha mRNA, FW: AGAGCCCCATCTGTCCTCTC, RV: ACTGGTAGTCTGCAAAACCAAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
24	VDRBP qPCR primers	primers for detection of mouse VDR binding protein mRNA, FW: CCTGCTGGCCTTAGCCTTT, RV: TGCTCAAATGTGCTACTGGAAA, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
23	ANGPTL4 qPCR primers	primers for detection of mouse ANGPTL4, FW: AAGATGCACAGCATCACAGG , RV: ATGGATGGGAAATTGGAGC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
22	ANGPTL3 qPCR primers	primers for detection of mouse ANGPTL3, FW: CCAGAACACCCAGAAGTAACT, RV: TCTGTGGGTTCTTGAATACTAGTC, Concentration used in qPCR is 250 nM, Stock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
21	mRIP140 qPCR primers	primers for detection of mouse RIP140 (Receptor Interacting Protein of 140 kDa)FW1: AGACCAGAACTTTAACCTCTCGGRV1: CGATGGAATCAGACAGCCTCTFW2:TGTCTTAACTTACCTCGAAGGGTRV2:CGTCTGGGTACTGACAGTGGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
20	mLRP2 qPCR primers		1	-20 C		Biomedical	Biology	Finland	Oulu
19	FGF21 qPCR primers	primers for detection of mouse FGF21FW: GTGTCAAAGCCTCTAGGTTTCTTRV: GGTACACATTGTAACCGTCCTCConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
18	NR1D1 qPCR primers	primers for detection of mouse Nuclear Receptor Subfamily 1 Group D Member 1FW: TCCCCAAGAGAGAGAAGCAARV: CTGAGAGAAGCCCACCAAAGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
17	CREBH qPCR primers	primers for detection of mouse CREBH (cAMP responsive element binding protein 3 like 3)FW: GTGTCACACCAGGGAGCAAGRV: CAGTGAGGTTGAAGCGGGAGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
16	Fetuin A qPCR primers	primers for detection of mouse Fetuin AFW: ATCCGCTCCACAAGGTACAGRV: GGTCCAAAGCATGGCAAGTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
15	CRP qPCR primers	primers for detection of mouse C-Reactive protein mRNA.FW: GGCCAGATGCAAGCATCATCRV: CTGGAGATAGCACAAAGTCCCACConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
14	AKT3 qPCR primers	primers for detection of mouse AKT Serine/Threonine Kinase3FW: TGGGTTCAGAAGAGGGGAGAARV: AGGGGATAAGGTAAGTCCACATCConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
13	AKT2 qPCR primers	primers for detection of mouse AKT Serine/Threonine Kinase2FW: ACGTGGTGAATACATCAAGACCRV: GCTACAGAGAAATTGTTCAGGGGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
12	AKT1 qPCR primers	primers for detection of mouse AKT Serine/Threonine Kinase1FW: ATGAACGACGTAGCCATTGTGRV: TTGTAGCCAATAAAGGTGCCATConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
11	VDR qPCR primers	primers for detection of mouse vitamin D receptor mRNA.FW: GAATGTGCCTCGGATCTGTGGRV: GGTCATAGCGTTGAAGTGGAAConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical	Biology	Finland	Oulu
10	Mouse Primary Hepatocytes	The mouse primary hepatocytes could be obtained from mice by two-step collagenase liver perfusion. If you are interested in obtaining mouse primary hepatocytes, please contact prof. Jukka Hakkola (jukka.hakkola@oulu.fi).	1	-70 C		Biomedical	Biology	Finland	Oulu
9	Mouse model of type 1 diabetes ( STZ-model)	Type 1 diabetic phenotype was induced by injecting the mice with either vehicle (sod. citrate buffer pH 4.5) or with STZ (60 mg/kg) once daily for 5 days. All mice were kept for a total period of 13 weeks. Additionally, one group of diabetic mice were treated with INSULIN twice a day for 4 weeks before sacrifice. Groups were as follow: 1-vehicle group (non-diabetic controls)= 10 mice 2-STZ group (diabetic mice left untreated)=14 mice 3-STZ + Insulin group (diabetic mice with insulin injections for 4 weeks before sacrificing= 10 mice. Tissues collected include liver, kidney, heart, muscles, duodenum, ileum, colon, different areas of the brain, brown adipose tissue, testis, and plasma. There is also paraffin blocks from some of these tissues	1	-70 C		Biomedical	Biology	Finland	Oulu
8	Mouse experiment (Knockdown the estrogen-related receptor alpha (ERRa) in the liver)	C57BL/6N mice, aged 8-9 weeks were inject with either SCR-Ad or ERRA-shRNA-Ad (5*10^9 IFU/mouse) via tail vein. The mice were kept for 8 days in total. Before scarifying, the mice were fed or 12h fasted. the treated mice were as follows SCR-Ad (fed or 12h fast) 10 mice/group and ERRA-shRNA-Ad (fed or 12 fasted) 10 mice/group, non-infected controls (fed or 12h fasted) 10 mice/group. the collected tissues include the Liver, Kidney, white adipose tissue, muscles, and Duodenum.	1	-70 C		Biomedical	Biology	Finland	Oulu
7	Mouse experiment (Knockdown the glucocorticoid receptor in the liver)	C57BL/6N mice, aged 8-9 weeks were inject with either SCR-Ad or GR-shRNA-Ad (2,4*10^9 IFU) via tail vein. The mice were kept for 8 days in total. Before sacrifying, the mice were fed or 12h fasted. the treated mice were as follows SCR-Ad (fed or 12h fast) 10 mice/group and GR-shRNA-Ad (fed or 12 fasted) 10 mice/group. the collected tissues include the Liver, Kidney, white adipose tissue, muscles, and Deudenum.	1	-70 C		Biomedical	Biology	Finland	Oulu
6	Mouse experiment (Inhibit the Glucocorticoid receptor in mouse liver by Mifepristone)	The aim was to inhibit the liver GR by GR antagonist mifepristone. C57BL/6N mice, aged 8-9 weeks, were injected with mifepristone (i.p. 100 mg/kg) or vehicle (DMSO/corn oil) two times (the first injection at 9 am and the second injection at 9 pm) and subsequently the mice were either fed or fasted overnight for additional 12h and the tissues were collected. the treated groups were as follow: Vehicle (fed or 12hfast) 8 mice/group and MIF (fed or 12h fast) 8 mice/group. the collected tissues include Liver, Kidney, white adipose tissue, muscles, whole heart, lung, Deudenum, colon, and brown adipose tissues.	1	-70 C		Biomedical	Biology	Finland	Oulu
5	Mouse experiment (Mifepristone plus Dexametahsone)	The aim was to inhibit the GR and abolish the effect of Dexamethasone on the gene of interest in the liver. C57BL/6N mice aged 8 weeks were injected fasted 1 h before an i.p. injection of dexamethasone (3 mg/kg) dissolved in DMSO/corn oil or vehicle only. Simultaneously with the dexamethasone injections, the GR was inhibited with the GR antagonist mifepristone (i.p. 100 mg/kg) dissolved in DMSO/corn oil. The treated groups are as follows Vehicle, DEXA only, MIF only, and DEXA+MIF, 7 mice/group. The collected tissues include the Liver, Kidney, white adipose tissue, and muscles.	1	-70 C		Biomedical	Biology	Finland	Oulu
4	Mouse experiment (Dexamethasone treatment)	C57BL/6N mice aged 8 weeks were fasted 1 h before an i.p. injection of dexamethasone (3 mg/kg) dissolved in DMSO/corn oil or vehicle only. The mice have fasted 6 h and the tissues collected. The treated groups were as follows vehicle and Dexa, 7 mice/group. The collected tissues include the Liver, Kidney, white adipose tissue, and muscles.	1	-70 C		Biomedical	Biology	Finland	Oulu
3	Hepa1c1c7	Mouse Liver Hepatoma	1	Liquid nitrogen		Biomedical	Biology	Finland	Oulu
2	Calu6	Lung carcinoma cell line	1	Liquid nitrogen		Biomedical	Biology	Finland	Oulu
1	C3A	HepG2/C3A, derivative of Hep G2	1	Liquid nitrogen		Biomedical	Biology	Finland	Oulu
2	HEK239	Human Embryonic Kidney	1	Liquid nitrogen		Biomedical science	Biology, Cell Biology, Biochemistry, Genetics, Zoolgoy	Finland	Oulu
1	HepG2	Human Hepatoma cell line	1	Liquid nitrogen		Biomedical science	Biology, Histology, Genetics, Cell Biology, Pharmacology, Physiology	Finland	Oulu
49	mErrgamma qPCR primers	primers for detection of mouse Estrogen-related receptor gammaFW1: GAATCTTTTTCCCTGCACTACGARV1: GCTGGAATCAATGTGTCGATCTTFW2: GACCCTACTGTCCCCGACAGTRV1: AACTCTCGGTCAGCCAAGTCAConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20C		Biomedical science	Biology, Biochemistry, Pharmacology, Physiology, Toxicology, Zoolgoy, Genetic Engineering, Interdisciplinary	Finland	Oulu
48	mErrbeta qPCR primers	primers for detection of mouse Estrogen-related receptor betaFW: CAGATCGGGAGCTTGTGTTCRV: TGGTCCCCAAGTGTCAGACTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	- 20C		Biomedical science	Biology, Pharmacology, Physiology, Toxicology, Zoolgoy, Interdisciplinary	Finland	Oulu
47	mGr qPCR primers	primers for detection of mouse Glucocorticoid receptor (NR3C1).FW: AGCTCCCCCTGGTAGAGACRV: GGTGAAGACGCAGAAACCTTGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.		-20 C		Biomedical science	Biology, Biochemistry, Anatomy, Cell Biology, Genetics, Pharmacology, Physiology, Toxicology, Zoolgoy, Interdisciplinary	Finland	Oulu
46	mAngptl8 qPCR primers	primers for detection of mouse Angioboitin-like protein 8FW: CACTGTACGGAGACTACAAGTGCRV: GTGGCTCTGCTTATCAGCTCGConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20C		Biomedical science	Biology, Biochemistry, Pharmacology, Physiology	Finland	Oulu
45	mPgc1a qPCR primers	primers for detection of mouse PGC-1aFW: TCCTCCTCATAAAGCCAACCRV: GCCTTGGGTACCAGAACACTConcentration used in qPCR is 250 nMStock100 uM, working dilution is 10 uM.	1	-20 C		Biomedical science	Biology, Physiology, Pharmacology, Biochemistry	Finland	Oulu
44	mCyp2r1 qPCR primers	primers for detection of mouse CYP2R1FW: AAACTACAACCAATGTGCTCCG, RV: ATTCCCAAGAAGGTCTCCTGT, Concentration used in qPCR is 250 nM Stock 100 uM, working dilution is 10 uM.	1	-20 C		Biomedical science	Biology, Biochemistry, Pharmacology, Physiology, Zoolgoy	Finland	Oulu
0	hydratase-3	enzyme	5 mg	stord at -70C	its frozen	Biomedical	Biochemistry	Finland	Oulu
0	dehydrogenase-4	enzyme	1mg	stored at -70C	its frozen	Biomedical	Biochemistry	Finland	Oulu
0	crotonase	enzyme	100 mg	-70C		Biomedical science	Biochemistry	Finland	Oulu
0	trans2-decenoylcooenzyme A	fatty acyl Coa susbtrate, lyophilized powder	1 mg	-20 C		Biomedical science	Biochemistry	Finland	Oulu
0	Cobalt Talon beads	cobalt talon beads for IMAC purification10ml	10ml	4C freeze x	regenerated talon beads	Biomedical	Biochemistry	Finland	Oulu
1								Finland	Oulu
	name	description	quantity		comments	categories	subcategories	country	city	lab